DNA Testing and Privacy (Behind the scenes at the 23andMe Lab) – Smarter Every Day 176


What’s up, I’m Destin, this is Smarter Every Day. You’ve probably heard of 23andme. It’s one of these companies where you spit in the tube and you mail it off and they do DNA testing and give you ancestry and health data. Well, here’s the deal They approached me and asked me if I would make a video on Smarter Every Day about them, and what they do But there’s a problem with that I’m really fascinated with this technology like I think this is the future of medicine. Imagine a doctor walking into your room opening a chart and saying “Oh well I can’t give you this drug because you’re genetically predisposed to a negative reaction” That is the future of medicine so I really believe this is important however I can’t do an ad for something this important and have you the viewer think that I’m just shilling for a company and saying what they want me to say because they’re giving me money, so I set up the following terms. I said, look, I’ll do this video if, number one, I get to ask any question I want of anybody and I get to say whatever I want as long as it’s true And they said yes to that and number two I want access to the labs with my camera And I want to be able to ask the scientist questions, and they said yes to that and that never happens ! That’s awesome. And number three I told them I actually wanted them to sponsor the video Which they did so to their credit, 23andMe is sponsoring a transparent video which is a little scary for them because they have no idea what I’m gonna say. So here we go, Let’s do this. When you get the kit. It’s pretty clear how this exchange works. I give up genetic material, and I get health and ancestry data back, but that’s scary I don’t know what they’re gonna do with my sample I don’t know exactly what I’m giving up. When I ask people on Twitter, everybody cited privacy concerns, so just for a second let’s pretend that we can’t trust this company we need to go to an independent third-party expert that knows exactly what type of information we’re giving up when we spit in a tube and mail it to 23andMe So when a lot of people think about, Huntsville, Alabama, they think about the space industry like the Saturn 5, right ? But what you didn’t know if you get on Google Maps and go to 601 Genome Way, you’re gonna see a double helix you can see from space. That is this place. No joke. Huntsville, Alabama is home to one of the largest DNA sequencing centers in the entire world and it’s in my hometown like I see these people at PTA meetings. The HudsonAlpha Institute for Biotechnology is where Dr. Neil Lamb, a PhD in human genetics works. We’re go in here and learn about DNA sequencing. Hey, are you Neil ?
NEIL>>I am DESTIN>>Hey, I’m Destin.
NEIL>>Nice to meet you DESTIN>>Nice to meet you, yeah
NEIL>>Welcome to HudsonAlpha DESTIN>>Chris nice to meet you guys Hey, how you guys doing, you doing all right?
NEIL>>Welcome to the Institute.
DESTIN>>Yeah, thank you. This is fancy. NEIL>>Is this your first time here ?
DESTIN>>No actually I upload stuff to the YouTube channel here because you have the fastest internet connection in the city Did you know I did that?
NEIL>>So we’re headed to the genome sequencing center which is the all of the sequencing machines that we have at HudsonAlpha. DESTIN>>Ok, so these are the sequencers right full-blown DNA sequencing.
NEIL>>These are DNA sequencers This is really the heart of HudsonAlpha. These machines are designed to take an individual or an organism to sequence it’s broken up into small pieces and the sequence A’s T’s C’s G’s…
DESTIN>>for the entire genome?
NEIL>>for the entire genome.
DESTIN>>Like how much data are we talking there, in bytes? NEIL>>So the raw data that comes out of this machine is about 80 gigabytes of information for one human genome. DESTIN>>Okay, this explains why the fastest internet node in the city is it HudsonAlpha.
NEIL>>That is correct DESTIN>>Does 23andMe have like a bank of machines like this ?
NEIL>>23andMe uses a completely different technology for genotyping DESTIN>>So what’s the difference in genotyping and full-blown DNA sequencing ?
NEIL>>So to answer that question let me show you another illustration. This is a representation of your genome. There’s a hundred notebooks on the bookshelf, and I want you to imagine that each of those notebooks, has 5000 double-sided pages full of nothing but DNA sequence.
DESTIN>>Adenine, cytosine, thymine and guanine.
NEIL>>Exactly right so you’ve got two copies that copy you inherited from your mom and the copy you inherited from your dad. So this is a representation of one of those two copies the amount of information that you’re gonna get from 23andMe is not all three billion bits of information. Instead, it’s more like about 90 pages.
DESTIN>>Really? Now, what’s the difference in genotyping and just doing a DNA sequence, what’s the difference in those two things? NEIL>>Right, in DNA sequencing, I’m reading through every single letter in your genome. With genotyping, I’m going to a specific place, and I’m saying at this one site, what do you have? And with genotyping I’m doing that… well for 23andMe they’re doing that at about 600,000 sites across your genome.
DESTIN>> So it’s not like you’re giving away your entire DNA sequence when you do something like this.
NEIL>>That’s right You’re only giving away a tiny fraction of your genetic information when you do something like 23andMe.
DESTIN>>Okay, Got it this it’s not your entire sequence I thought it was I thought they were gonna be Destin clones walking the streets But if you do the math it’s only 0.02% of your sequence. That’s a game-changer They should like put that on the website or something. Okay, was at this point that I was invited to an education summit headquarters in Mountain View, California. My wife, who’s really smart when it comes to genetics, insisted that she take my place for reasons, I’ll let her explain TARA>>I am a medical professional as someone who’s done genetic research in the past and wanted to know if it would benefit you guys there were if it would harm you guys So I’m here !
DESTIN>>This part is super cute to me because she doesn’t like to be on camera that much But I asked her to vlog just a little bit She went and talked to professors and researchers from all over the country And they discussed the different benefits and risks of doing this type of testing both on the individual level and its overall implications for society The main thing she learned is that the optional questions are the key. When people answer the question scientists can start to figure out what genotypes affect what traits. We decided, as a family, that we want to contribute to the overall genetic body of knowledge because that’s going to help society in the future. Okay, after you decide to spit you were about to send your genetic information off to a third party. Kind of scary… so a set up an email address Specifically to do the kit and it’s pretty interesting because there’s no return address so really the only indicator for which tube is mine is this 14 digit code. I spit in the tube, you’re smart, you can figure that part out and you write down that 14 digit code on the tube and link that to the email address and that goes to 23andMe headquarters. The kit however, does not go to 23andMe headquarters it goes to LabCorp, a completely different company after doing some research I discovered that 23andMe has isolated themselves physically from the samples. LabCorp has samples and numbers 23andMe has email addresses and numbers I decided to spit in this thing and then chase it out to California to see what happens when it hits the door of the lab. This is the first time LabCorp allowed someone like me into the lab with a camera I was introduced to the lab manager Amanda Douglas and was told I could film anything and ask any question I wanted AMANDA>>So we’re at the National Genetic Institute DESTIN>>National Genetics Institute okay.
AMANDA>>It’s a subsidiary of LabCorp. DESTIN>>No way is that the FedEx guy that brings brings the stuff in? What’s up, man? Do you bring all the samples here?
FedEx Guy>>Yes I do.
DESTIN>>Nice to meet you man. This is way more behind the scenes than I thought it was gonna be AMANDA>>This is a small batch so we open them by hand but with larger batches there’s a conveyor belt DESTIN>>Really?
AMANDA>>And that will cut them open DESTIN>>And so you open them and you… Oh! He’s actually got the sample, okay, so what’s your name man?
LONNIE>>Lonnie.
DESTIN>>Lonnie, I’m Destin, man Nice to meet you. All right, so we got our spit in the system now what? AMANDA>>Alright, so now that the spit is in the system, we’ll know… ok, let’s go ahead and test the ones that are ready to test and then they’ll move on to the lab.
DESTIN>>Is that where we’re going now?
AMANDA>>That’s where we’re going now. DESTIN>>Sweet. These are all specimens here. So Lonnie has done his thing, we come in here, and we’re ready to extract the DNA.
AMANDA>>That’s right. DESTIN>>Okay
AMANDA>>So we’ll go on here DESTIN>>Oh, this is so rad… Oh god ! This is like from the future. What are you guys doing?
LAB TECHNICIAN>>I’m currently uncapping specimen sample, to be able to put them into the Tecan which will then take a little small amount of this into the 96-well plate. DESTIN>>Okay, so these machines are autonomously taking the samples out of the specimen tube that people mailed in and then it’s Automatically putting those into the 96-well plate. That’s what we’re doing Got it. Okay, so this is the first time where we no longer have humans touching it, and we’re moving towards machine automated process.
LAB TECHNICIAN>>Exactly. DESTIN>>Is that it? I would high-five you, but you get gloves on. I spent the entire day with Amanda learning the whole process and basically it works like this. First they isolate the DNA and then they amplify it by allowing it to replicate and then the magic happens. This chip is the secret to genotyping. Basically they take the DNA, and they unzip the double helix which leaves you with one side of a ladder rung they then put this unzipped DNA onto the chip which has thousands of artificial DNA probes on it these probes are basically long stretches of DNA that match known parts of the human genome So when a ladder comes along and gets beside the probe it’s a perfect match and will bind to it Since this stretch of DNA is a known sequence you can then read the next base pair That’s hanging off of the probe and that’s the specific information for that base pair They do this by a fluorescent marker that they’ll put on the chips which reacts to different kinds of light these specific locations are chosen because they’re associated with something interesting like a disease risk or a physical trait this fancy machine illuminates the chips and takes a picture, which tells you what letter you have at that particular DNA snip Or single nucleotide polymorphism, and that’s it. That’s how the data is captured the next thing I wanted to know is what happens after your sample is tested. On the website, you could choose to allow lab core to keep the sample on long-term storage for future testing or You can check a box and tell them to destroy it I asked Amanda if she would show me this because a lot of people want to know if they check that box It’s actually gonna happen. Amanda has agreed to show me the process. It’s really exciting I’m told.
AMANDA>>Oh Yeah, you’re in for an excitement here, so we take a box of 120 samples that we’ve scanned and said “this sample is to be discarded”, the customer does not want to store it long-term So once they’re ready to be discarded. We’ll take the samples and throw them in to the trash And we simply toss them into the trash pour the whole box in the trash. DESTIN>>That’s it?
AMANDA>>That’s it
DESTIN>>And then what happens to it? Like you I really expect you that you’re hiding the samples somewhere, right? You’re gonna do something crazy with them, right? AMANDA>>We just throw them away.
DESTIN>>And they go and they are destroyed at a biomedical waste facility.
AMANDA>>That’s right
DESTIN>>So we’re kind of goofing around here but it is important, so she showed me the entire process the samples are consolidated They’re kept under lock and key, and they’re picked up daily It’s legit. So I am satisfied with the process obviously 23andMe knew I would be satisfied or they wouldn’t have allowed me to do this, but it was really fun to anyway I really enjoyed the ancestry data a lot more than I thought I would I elected to talk to my dad about it We had a really good discussion, and we actually learned things about our family together. The health stuff is interesting though. It is your responsibility to understand what those results mean and to get a better handle on this I decided to go talk to Dr. Lamb again the unbiased third party at HudsonAlpha.
NEIL>>I found the information really fascinating it gave me some insight into myself But I’m… I have a background in human genetics That’s my PhD so I got all the nuances I understood what that means and what that doesn’t mean
DESTIN>>So what you’re saying is even if someone does 23andMe and they get that information about their own body, it’s important to go the next step and understand what you’re learning about your body? That’s what you’re saying.
NEIL>>and to bring your medical doctor into those conversations and to make sure that your doctor understands the nuances of genetics as well. They’re a piece of information and you’ve got to make sure you understand what that piece can and can’t tell you and in a lot of cases you have the Decision you can make the decision do I want to even know this information? Or do I want to not look at that part of my report.
DESTIN>>Got it okay and to be clear Neil has nothing to do with 23andMe.
NEIL>>That’s correct,
DESTIN>>Okay, so that’s an unbiased third-party opinion Thank you for that.
NEIL>>My pleasure. DESTIN>>Okay, in summary. I was concerned about privacy. I went to the lab I am no longer concerned about privacy. They’ve got a good handle on that. You were concerned about the data the benefits outweighing the risks do you feel like it does?
TARA>>I do feel like the information is helpful for Society as a whole as well as the individual
DESTIN>>Okay, and there’s three things you said you wanted to bring up TARA>>I did. One, I want you to realise that just because report says that you have a marker It doesn’t mean you’re gonna get that means like you’re more or less likely to have that trait. Number two only gather the information that you think you can handle so if you think hey I’m not sure I want to know that then then wait.
DESTIN>>Some people only do the ancestry thing because they don’t want to know those health risks TARA>>Right and three you need to realize that it’s a family affair. I mean once you find out your data You’re it’s really your family’s data So you may have to make decisions on whether you should share that information with your Mother and father or brother and sister or whether you shouldn’t.
DESTIN>>If this is something you want to do you can go to 23andme.com/smarter, get a tube spit in it send it off and get your data back if you want to do that feel free to if not no big deal Thank you to 23andMe for actually letting us more or less investigate their company and being so transparent that was pretty cool. Nobody’s ever gone into the lab like that before you think it’s a good thing TARA>>I think it’s a fun thing yeah. DESTIN>>Anyway, I’m Destin you getting smarter every day. It’s my wife Tara That’s it. Have a good one Bye. No private or health information about any individual was recorded or shared in the making of this video I am gonna try to vlog for the first time. I’m not comfortable on camera, so this should be pretty interesting. Even in the screen and it’s not if I guess oh, I keep looking at the screen you are going to I keep looking at the screen I’m not good at this Okay next

100 thoughts on “DNA Testing and Privacy (Behind the scenes at the 23andMe Lab) – Smarter Every Day 176”

  1. No offense Destin but there are still many unknowns about this. I understand the benefits but my gut feel is that there are "entities" that would salivate (like the metaphor?😏) for dna information.

  2. I have to admit I’m disappointed by how little you made of your opportunity to ask critical questions. I don’t wanna be a downer or anything but pseudonymization and physical separation do not make this process safe from a privacy standpoint.

  3. There's still a privacy issue, if you collect someone else's split and send them to 23 and me, you get their data without them knowing, scary!

  4. I just don’t like how to US Government or any body could get that info and tie me to something like they did the Golden State Killer; not that I plan on doing any crimes in the future.

  5. While the premise is interesting and you covered what happens to samples after. You didn't cover what they use the samples for besides a genetic report. The data must be used for something else. It's a LOT of work and data storage just to give someone a report on themselves.

  6. why was the question, "do you share or allow access to the data from government agencies or law enforcement?" Why was that question not asked? A fairly fundamental question on an investigational report, not so much on an advert though.

  7. so customers check the [X] Destroy box and instead of being destroyed, the samples are given to someone else – the biohazard trash company. The trash company could hypothetically sell those tubes to mafia who can use it to put fake DNA on murder scenes, framing you for a murder.

  8. funny how just last day I saw his video about the NASA moon rock lab, and it just seemed like the most normal thing to me that he goes to these labs.
    the way he acted and talked with the people
    and here I am the next video I see was his first time going to a lab 🙂

  9. What concerned me the most was if the work was legitimate. I want to know if the information is real or if it is fabricated.

  10. Thanks for the informational video. Also tell camera shy Terra thank you for her part in making this video as well.

  11. Destin, I see you cover your laptop camera with tape. I do the same. Why do you choose to do that? Just curious.

  12. Nice video… but you didn't read the agreement, especially the law and government automatic access to DNA database… is already been useful to the capture of criminals, the family did the test and the police found out a match on their DNA scanners

  13. Oh so they only do genotyping but they have your actual spit sample still? Well just dont use it for anything else guyzzz lol

  14. Threw some tube away, they picked up some totes…. must be legit, either destin is hella gullible or a shill… I'd take the latter

  15. Unless people that are against this have proof that DNA data has been used in the negative you're doing nothing but speculating and creating fear mongering. And, me typing this should show that I'm actually wanting to believe in what some are worried about. But, without proof I'm not just going to blindly believe you either. That's the scientific way to approach things like this.

  16. Good luck, I still don't trust them. Take a look at some of their customers, your data buyers. Read their contract, it says they can sell your DNA data to anybody..

  17. These DNA companies have already been proven non-secure from the federal government. Warrants have been issued and granted in order to obtain family traits in order to find and prosecute within the justice system.

    I'm not down.

  18. Amazing information, and funny all comments about "Windows XP" clearly you haven't worked in IT in any major industry its all about compatibility its getting better now but as someone pointed out to go from XP – Win10 in that scenario would be of astronomical cost and in some ways less stable

  19. So they put on lab coats but the delivery guy comes right in off the street and shakes his hand. How clean can that possibly be?

  20. It's not the destruction of the physical sample that's the worry, but rather the question of what happens to the information they have extracted from it. Can law enforcement access it? Other private companies? What if they shut down in the future; will they sell the data?

  21. Just because they say they aren't taking your entire genome doesn't mean they actually aren't…wasn't that the whole idea was to see if you can trust them? If you were just gonna ask them…..smh

  22. 4:39 imagine all of the similar processes that happen in your body and every other human body on earth. that is the majority of the human genome. but the .02% of information they collect is all they need to distinguish you from the next person they collect. they make it sound like nothing but that little fraction still carries a lot of information

  23. But, you did not show what happens to the DNA samples after they are picked up from the facility. Is the company that picks them up bonded? Are samples burned or buried? How are they transported? Saying they are disposed of properly and doing so are two different things.
    I'd say it's cause for a more detailed investigation.

  24. Oh my flippin gosh I've never wanted to talk to a YouTube person than now you from the city I was born in and I get to learn more about my feildtrips and even more stuff. I dont sven know. your awesome.

  25. I wonder if anyone sends their per instead???! I wonder if they would go ahead and use the sample. anyhow…

  26. Hey Destin, my concern is, is this governed, what measures and checks are in place to prevent a company giving random data based on a much smaller genotype (which I assume would be cheaper) instead of doing a thorough genotyping?

  27. OK so they throw away the sample no big deal however, the data is the major issue. Once they gather the data and report to you the findings do they delete the data? I assume not. It's like the personal issues with Facebook privacy. You don't own that data and they can do whatever they want with it like sell it for example. No thank you. Not until They have solid proof of not to use it maliciously.

  28. The sample has 100% of your DNA
    You test for 2% to show the donor……. That is 2%
    But you have 100% in the sample provided by the donor which you can test for your own files….. And not shown to the donor
    Only talking about 2%??!!
    A little bit slippery there I think!!

  29. "It will help society in the future". Dude! Do you even 1984?

    The problem in the way people like you (Destin) look at this sort of thing is the complete lack of caution. It is like the CO2 debacle, you don't know nither the ellasticity of any of the variables nor the sensitivity of discrete data points. In this case, however, the questiion you DIDNT ask is what scares me: what human traits are being measured by that specific .002%?

    Imagine, if you will, that these .002% is the best and most precise method to predict intelligence, agreeableness or agresiveness. What do you think this PRIVATE COMPANY will do with this knowledge?

    Jesus man, think a little for yourself instead of spilling poorly understood academic jargons!

  30. No, you ARE giving away your ENTIRE DNA sequence (you can't limit it) …THEY are just testing a small portion of it (supposedly).
    You need to realize, that EVERY single sample in testing (ever!) is at a loss in money (they LOSE money doing the testing). What business would do that?! Where is the money coming from to supplement the testing cost to pay for everything? The ancestral connections/heritage is NOT scientifically accurate …it is solely based on matching it to the SMALL database of OTHER people who have submitted DNA to them, and what THEY revealed about themselves on paper, origin-wise.

  31. 23 and the New World Order.

    "We can't let you LIVE because you are genetically predisposed to rebel against our totalitarian dictatorship."

  32. Based on the comments section this video is misleading, you dodged all the critical questions in a conniving way, your interviews gave misleading information and you branded this video as "transparent" 1 minute in despite all this AND being sponsored by them. Amazing how this video even has such a high like ratio. Smoke and mirrors.

  33. Don't trust them. They we sell your information, and allow anyone to use it. No one but your self should be allowed to it.

  34. I'd like to compare their results to the million dollars worth of medical DNA testing I've had done. COL71A where you at though?

  35. I did my DNA through Ancestry and then ran it through a health program called Prometheuse. I did it because everyone in my family dies of cancer, and I wanted to see if it said I was genetically predisposed. Well, guess what? It came back and said I have the BRCA-1 gene mutation, the gene that gives you a 70% chance of breast cancer and 40% chance of ovarian cancer and a high risk of other cancers. I was so upset. I grieved, I obsessively researched, I cried…. it was terrible. Then I went to my gynecologist to discuss my options. She redid the test just to be sure, and 2 months later…. it came back negative. Turns out I never had the BRCA-1 gene mutation; Prometheuse just told me I did. I spent 3 months of my life freaking out and telling my family to get tested… It was rough. So user beware when you get your results back! 🙁

  36. why is everyone so worried about people getting there dna

    you flush big steaming dna loafs down the toilet every day if someone REALLY wanted your dna they could make this happen

  37. The bio-"waste" is secretly picked up nightly at 3AM by a nefarious, clandestine group of evil scientist ninjas who are operating an underground project of supplying and farming body parts and stem-cells from viable clone and the DNA provided. Each clone maintains a barcode, an alias, and a function. Select high quality "Farm Clones" are kept on life-support, to be harvested and replenished with fresh stem cells from the disposable lot, to then regrown the next season's body parts stock pile.
    The reject / failed clones beyond a certain size are sanitized and processed in a massive meat grinder, to then be packaged and shipped to your local grocer by assigned worker clones called "Duty Clones" . These Duty Clones are sustained by feeding off this meat supply.

    When a product's label boasts: "No animal testing", you can guarantee there was a clone in place for testing instead.

    GATACAGATACACACAGTCGAATGCGGCATGCTCGATCGATCGATGCTAGCTAGCTGCATGCTAGCTAGCTGATCGATGCTAGCTAGTCGATCGTAGCATCGTAGTCGTAGTAGTCGTGACTGTGCGATCGATGCTGAGCGAGCGACTGATCGATCGTAGCTAGTCGTAGCTAGTCGATGCTAGCTGCGGCGACTATCGATGCTAGTCGATTTACTGATCGGATCGAGCGATCGTAGCTGATGCTGATCGTACGTCGATGCTAGCTAGCTAGCTAGCTAGCTGATCGTCGTAGCTAGCTGATCGTAGCTGATCGTACTGTAGCTGATGCTGATCGTAGCATGCTAGCTAGCTAGCTAGCTGATGCTAGCTGATGCTGATGCTGTACGTGTTATCTGAGCGAGCGACGTACGATCGAGCTAGCGTAGCTTGCTACTAGCATCGGCGACGACGTTAGCTGATCGTACGATCGATCACGCGCTATCTATCGAGCTTCGATCGATGCGAGCTGATGATCGATCGATCGTATCGGACGTAGCTGATCTATCGAGCTGATCGTACGTACGTAGCTGATCGATGCTAGCTAGCTGATCGATGCTAGCTAGCTAGCTGATCGTAGTCGTAGCTGA

  38. I'm so very disappointed you published this. I would give away my Social Security number before my DNA. Your DNA doesn't just identify you by name, it is the God-driven genetic program to every molecule of your body, which no other person has. This company along with other DNA collectors have had multiple breaches, dumping DNA material in the hands of who knows what. Possibly a way to determine what kind of dirty bomb would take out a bigger part of the population? How to engineer a virus to better attack the populous with less resistance against it. They wanted you (SED) to produce a video for them to help "ease" the public's mind and let their guard down. With CDC connections, this is a very bad monster hidden in a box. I have to unsubscribe from your channel as well. This has rattled me to the core. I so fear we have such a denial and blind eye to the very enemy within. Sorry- but I must unsubscribe.

  39. The whole DNA testing company's are getting people to sell their "services" to people just so they can wait 40-50 years to advertise their "young" dna sells to make them look 20 again at a ridiculous price.

  40. "I want access to the labs with my camera,
    And I want to be able to ask the scientist questions,
    and they said yes to that and THAT NEVER HAPPENS.
    That's awesome."
    (Wait W H A T?)
    Did I misunderstood any words here?

  41. Can you deep dive the way the analyze the ancestry data? I've heard very mixed things about it and how their sample data doesn't scientifically give them the level of certainty that they imply with their reports to customers.

  42. You can take my dna and sell it to everyone you like. You can knock at every door in USA and any other part of the world and give them my dna details.

  43. You have a beautiful, intelligent wife, who cares about people. This seems (at an outside superficial level) to be a wonderful fit and I hope to see her and your family more in future. And yes, I see this is a two year old video, so I hope things are well for all of you. I'm new to the channel, one of 7.1M people who love the kinds of things you talk about – loves to learn – loves to explore things that I have not explored before. You are doing an awesome service. Thank you.

  44. 23andMe will still give your info to any government organization that wants it. It's in their terms of service

  45. They sponsored the video. All of the magic spells prior to him speaking that fact were mind control to get you believe that he's transparent. Because of this he seems shady. The opposite of transparent.

  46. If they advertised .02% nobody would want their garbage. It is self proving how inadequate your testing is. Moron. That's not getting smarter, guy.

Leave a Reply

Your email address will not be published. Required fields are marked *